Yearly Archives: 2021

Question 1.
Group the following as nitrogenous bases and nucleosides:
Adenine, cytidine, thymine, guanosine, uracil, and cytosine.
Solution:
Adenine, Guanosine, Thymine, Uracil, and Cytosine are nitrogenous bases. (Adenine and Guanosine → Purine, Thymine, Uracil and Cytosine → Pyrimidine) Cytidine is a nucleoside.

Question 2.
If a double-stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Solution:
According to Chargaff’s rule, in a double-stranded DNA, the total number of cytosine molecules will be equal to the number of guanine molecules and the number of adenine molecules will be equal to the number of thymine molecules. Therefore, if a double-stranded DNA has 20 percent of cytosine then the guanine will also be 20 per cent. The remaining 60% will consist of adenine and thymine in equal amount. Thus adenine will be 30%.

Question 3.
If the sequence of one strand of DNA is written as follows:
5′-ATGCATGCATGCATGCATGCA
TGCATGC-3′
Write down the sequence of complementary strand in 5′ -> 3′ direction.
Solution:
5′-GCATGCATGCATGCATGCAT G C ATG CAT-3′.

Question 4.
If the sequence of the coding strand in a transcription unit is written as follows: 5′-ATGCATGCATGCATGCATGCATGCATGC-3′ Write down the sequence of mRNA.
Solution:
If the sequence of coding strand is :
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Then template strand is :
3′ – TACGTACGTACGTACGTACGTACGTACG – 5′
The mRNA will be formed on the template strand in 5′ —> 3’ direction. Thus mRNA sequence will be:
5′-AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′
Thymine in DNA is substituted by uracil in RNA.

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesise a semi-conservative mode of DNA replication? Explain.
Solution:
The two strands of DNA show complementary base pairing. This property of DNA led Watson and Crick to suggest a semi-conservative mechanism of DNA replication in which one strand of a parent is conserved while the other complementary strand formed is new.

Question 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases
Solution:
DNA dependent DNA polymerases and DNA dependent RNA polymerases.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic
material?
Solution:
They raised 2 types of bacteriophages

• On radioactive phosphorous (³²P)
• On radioactive sulphur (³⁵S).

³⁵S gets into protein and ³²P into DNA When both bacteriophages infected bacteria differently and by shaking them, the viral protein coat was separated

After raising these bacteria it was found that those infected with ³²P bacteriophage → radioactivity were found. But with ³⁵S → no radioactivity was found.

Question 8.
Differentiate between the following:

1. Repetitive DNA and Satellite DNA
2. Template strand and Coding strand
3. mRNA and tRNA

Solution:

1. Differences between repetitive DNA and satellite DNA are as follows:
   
   
2. Differences between template strand and coding strand are as follows:
   
   
3. Differences between mRNA and tRNA are as follows:
   
   
   
   

Question 9.
List two essential roles of ribosome during translation
Solution:
Two essential roles of the ribosome during translation are:

1. One of the RNA acts as a peptidyl transferase ribozyme for the formation of peptide bonds.
2. The ribosome provides sites for attachment of mRNA and charged tRNA for polypeptide synthesis.

Question 10.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Solution:
The lac operon is regulated by the amount of lactose in the medium where the bacteria are grown. When the amount of lactose is exhausted in the medium, the lac operon shuts down.

Question 11.
Explain (in one or two lines) the function of the followings:

1. Promoter
2. tRNA
3. Exons

Solution:

1. Promoter: It is located at the 5′ end of the transcription unit and provides site for attachment of transcription factors (TATA Box) and RNA polymerase.
2. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome so that they can take part in protein formation.
3. Exons: In eukaryotes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are both transcribed and translated.

Question 12.
Why is the Human Genome Project called a mega project?
Solution:
The human genome was a megaproject that aimed to sequence every base in the human genome. The estimated cost of the project would be a billion (1 billion = 100 crores) US dollars.

Question 13.
What is DNA fingerprinting? Mention its application.
Solution:
DNA fingerprinting is the identification of differences in specific regions of DNA sequences based on DNA polymorphism, repetitive DNA, and satellite DNA.
Application of DNA fingerprinting: Settling, paternity disputes and identity of criminal by different DNA profiles in forensic laboratories.

Question 14.
Briefly describe the following:

1. Transcription
2. Polymorphism
3. Translation
4. Bioinformatics

Solution:
1. Transcription – It is the process of copying genetic information from the anti-sense or template strand of the DNA into RNA. It is meant for taking the coded information from DNA in nucleus to the site where it is required for protein synthesis. Principle of complementarity is used even in transcription. The exception is that uracil is incorporated instead of thymine opposite adenine of template. The segment of DNA that takes part in transcription is called transcription unit. It has three components

• • a promoter,
  • the structural gene and
  • a terminator.

2. Polymorphism – It is the variation at genetic level, arisen due to mutations. Such variations are unique at particular site of
DNA. They occur approximately once in every 500 nucleotides or about 107 times per genome. These are due to deletions, insertions, and single-base substitutions. These alterations in healthy people, occur in non-coding regions of DNA and do not code for any protein but are heritable. The polymorphism in DNA sequences is the basis of genetic mapping of human genome as well as DNA fingerprinting.

3. Translation – It is the mechanism by which the triplet base sequence of mRNA guides the linking of a specific sequence of amino acids to form a polypeptide chain (protein) on ribosomes in the cell cytoplasm. All the protein that a cell needs are synthesised by the cell within itself.
The raw materials required in protein synthesis are ribosomes, amino acids, mRNA, tRNAs and amino acyl tRNA synthetase. Mechanism of protein synthesis involves following steps:

• • Activation of amino acids
  • Charging or aminoacylation of tRNA
  • Initiation
  • Elongation (Polypeptide chain formation)
  • Termination

The ribosomes move along the mRNA ‘reading’ each codon in turn. Molecules of transfer RNA (tRNA), each bearing a particular amino acid, are brought to their correct positions along the mRNA, molecule base pairing occurs between the bases of the codons and the complementary base triplets of tRNA. In this way, amino acids are assembled in the correct sequence to form the polypeptide chain.

4. Bioinformatics – Bioinformatics is the combination of biology, information technology and computer science. Basically, bioinformatics is a recently developed science which uses information technology to understand biological phenomenon. It broadly involves the computational tools and methods used to manage, analyse and manipulate volumes of biological data.

Question 1.
What do you think is the significance of reproductive health in a society?
Solution:
Significance of reproductive health in society are:

• Control over the transmission of STDs.
• Less death due to reproduction-related diseases like-AIDS, cancer of the reproductive tract.
• Control in a population explosion.
• Not only the reproductive health of men and women affects the health of the next generation.

Question 2.
Suggest the aspects of reproductive health which need to be given special attention in the present scenario.
Solution:
Providing medical facilities and care to the problems like menstrual irregularities, pregnancy related aspects, delivery, medical termination of pregnancy, STDs, birth control, infertility. Post-natal child maternal management is another important aspect of the reproductive and child health care programme.

Question 3.
Is sex education necessary in schools? Why?
Solution:
Yes, sex education is necessary for schools because:

• It will provide proper information about reproductive organs, adolescence, safe, hygienic sexual practices, and Sexually Transmitted Diseases (STDs).
• It will provide the right information to avoid myths and misconceptions about sex-related queries.

Question 4.
Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement.
Solution:
The reproductive health in our country has improved in the last 50 years. Some areas of improvement are :

• Massive child immunization.
• Increasing use of contraceptives.
• Better awareness about sex related matters.
• Increased number of medically assisted deliveries and better post-natal care leading to decreased maternal and infant mortality rates.
• Increased number of couples with small families.
• Better detection and cure of STDs and overall increased medical facilities for all sex related problems.

Question 5.
What are the suggested reasons for the population explosion?
Solution:

• Improved medical facilities
• Decline in death rate, IMR, MMR
• Slower decline in birth rate.
• Longer life span.
• Lack of 100% family planning and education among the village.

Question 6.
Is the use of contraceptives justified? Give reasons.
Solution:
Yes, the use of contraceptives is justified: To overcome the population growth rate, contraceptive methods are used. It will help in bringing birth rate down & subsequently curb population growth. With the rapid spread of HIV/ AIDS in the country, there is now a growing realization about the need to know about contraception & condoms.

Question 7.
Removal of gonads cannot be considered as a contraceptive option. Why?
Solution:
Removal of gonads not only stops the production of gametes but will also stop the secretions of various important hormones, which are important for bodily functions. This method is irreversible and thus, can not be considered as a contraceptive method.

Question 8.
Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment.
Solution:
Amniocentesis is a prenatal diagnostic technique to find out the genetic disorders and metabolic disorders of the foetus. Unfortunately, the useful technique of amnio-centesis had been misused to kill the normal female foetuses as it could help detect the sex of foetus also. Hence, this technique is now banned in our country. This ban is necessary as this technique was promoting female foeticide in our country.

Question 9.
Suggest some methods to assist infertile couples to have children.
Solution:
If the couples are enabled birth to the children and corrections are not possible, the couples could be assisted to have children through certain special techniques, commonly known as Assisted Reproductive Technologies (ART). Some methods are given as:

1. In Vitro Fertilization (IVF): In this method, ova from the female and the sperm from the male are collected and induced to form a zygote under simulated conditions in the laboratory. This process is called In Vitro Fertilization (IVF). Some method is given as follows:

• Zygote Intrafallopian Transfer (ZIFT): The zygote or early embryo with up to 8 blastomeres is transferred into the fallopian tube.
• Intra-Uterine Transfer (IUT): Embryo with more than 8 blastomeres is transferred into the uterus in females who cannot conceive embryos formed by the fusion of gametes in another female are transferred.
• Test tube baby: In this method, ova from the donor (female) and sperm from the donor (male) are collected and are induced to form a zygote under simulated conditions in the laboratory. The zygote could then be transferred into the fallopian tube and embryos transferred into the uterus, to complete its further development. The child born from this method is called a test-tube baby.

2. Gamete Intra Fallopian Transfer (GIFT): It is the transfer of an ovum collected from a donor into the fallopian tube 8 another female who cannot produce one, but can provide a suitable environment for fertilization and further development of the embryo.

3. Intra Cytoplasmic Sperm Injection (ICSI) : It is a procedure to form an embryo HI* the laboratory by directly injecting the sperm into an ovum.

4. Artificial Insemination (AI): In this method, the semen collected either from the husband or a healthy donor is artificially introduced into the vegina or into the uterus (Intra Uterine Insemination, IUI). This technique is used in cases where the male is unable to inseminate sperms in the female reproductive tract or due to very low sperm counts in the ejaculation.

5. Host Mothering: In this process, the embryo is transferred from the biological mother to a surrogate mother. The embryo then develops till it is fully developed or partially developed. It is then transferred to the biological mother or into any other. This technique is useful for females in which embryo forms but is not able to develop.

Question 10.
What are the measures one has to take to prevent contracting STDs?
Solution:
Diseases or infections which are transmitted through sexual intercourse are collectively called sexually transmitted diseases (STDs) or reproductive tract infections (RT), e.g., gonorrhea, syphilis, genital herpes, AIDS, etc. The measures that one has to take to prevent from contracting STDs are:

• Avoid sex with unknown partners/multiple partners.
• use condoms during coitus.
• In case of doubt, go to a qualified doctor for early detection and get complete treatment if diagnosed with the disease.

Question 11.
State True/False with an explanation.

1. Abortions could happen spontaneously too.
2. Infertility is defined as the inability to produce viable offspring and is always due to abnormalities/defects in the female partner.
3. Complete lactation could help as a natural method of contraception.
4. Creating awareness about sex related aspects is an effective method to improve the reproductive health of people.

Solution:

1. True: One-third of all pregnancies abort spontaneously (called miscarriage) within four weeks of conception and abortion passes unrecognized with menses.
2. False: Infertility is defined as the inability of the couple to produce viable offspring. It is due to abnormalities/defects in either male or female or both.
3. True: Complete lactation is a natural method of contraception as during this period ovulation does not occur, but this is limited to a period of 6 months after parturition.
4. True: Creating awareness in people about sex-related aspects like right information about reproductive organs, accessory organs of reproduction, safe and hygienic sexual practices, birth control methods, care of pregnant women, post-natal care of mother and child, etc., can help in improving the reproductive health of people.

Question 12.
State True/False with an explanation.
(a) Abortions could happen spontaneously too. (True/False)
Answer:
False, Abortion does not happen under normal conditions. It happens accidentally or under the will of Parents.

(b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False)
Answer:
False, Sterility always does not occur due to females sometimes. Males are also responsible for this.

(c) Complete lactation could help as a natural method of contraception. (True/False)
Answer:
True, the Menstrual cycle does not occur after parturition which can act as natural
contraception but this method is functional for a period of six months from parturition.

(d) Creating awareness about sex related aspects is an effective method to improve the reproductive health of dead people. (True/False)
Answer:
True, this creates better reproductive health among people.

Question 1.
Fill in the blanks.

1. Humans reproduce___(asexually/ sexually).
2. Humans are ___(oviparous/ viviparous/ ovoviviparous).
3. Fertilisation is___in humans (external/internal).
4. Male and female gametes are___ (diploid/haploid).
5. Zygote is___(diploid/haploid).
6. The process of release of ovum from a mature follicle is called___
7. Ovulation is induced by a hormone called ___
8. The fusion of male and female gametes is called___
9. Fertilisation takes place in ___
10. Zygote divides to form___which is implanted in uterus.
11. The structure which provides vascular connection between foetus and uterus is called ___

Solution:

1. sexually;
2. viviparous;
3. internal;
4. haploid;
5. diploid;
6. ovulation;
7. LH;
8. fertilisation;
9. ampullary-isthmic junction of Fallopian tube;
10. blastocyst;
11. placenta

Question 2.
Draw a labelled diagram of male reproductive system.
Solution:

Question 3.
Draw a labelled diagram of female reproductive system.
Solution:

Question 4.
Write two major functions each of testis and ovary.
Solution:
Testis:

1. The seminiferous tubules of the testis produce sperm.
2. The Leydig cells of testis produce hormones such as androsterone and testosterone, together called androgens.

Ovary:

1. Produce ovum
2. Produce ovarian hormones such as estradiol, estrone, and estriol collectively called estrogens.

Question 5.
Describe the structure of a seminiferous tubule
Solution:
Seminiferous tubules are located in the testicles, and are the specific location of meiosis, and the subsequent creation of gametes, namely spermatozoa.

The lining of seminiferous tubules called germinal epithelium contains two types of cells – primary germ ceils which undergo spermatogenesis to form spermatozoa and columnar indifferent cells (derived from coelomic epithelium) which enlarge to form Sertoli cells. Sertoli cells function as nurse cells for providing nourishment to the developing spermatozoa, phagocvtise defective sperm and secrete protein hormone inhibin (which inhibits FSH secretion).

The seminiferous tubules are situated in testicular lobules. Both ends of the tubule are connected to the central region of the testis and form a network of small ductules called the rete testis.

Question 6.
What is spermatogenesis ? Briefly describe the process of spermatogenesis.
Solution:
Spermatogenesis is the process by which male spermatogonia develop into mature male gamete, spermatozoa. It starts at puberty and usually continues uninterrupted until death, although a slight decrease can be discerned in the quantity of produced sperm with increase in age. The process of spermatogenesis includes the formation of spermatogonia from germinal epithelium (primordial germ cell) through mitosis (multiplication phase). Finally they stop undergoing mitosis, grow and become primary spermatocytes (growth phase). Each spermatocyte undergoes meiosis (maturation phase). First maturation division is reductional, and produces two secondary spermatocytes. The latter divides by equational division (second maturation division) to form four haploid spermatids. Spermatids receive nourishment from the Sertoli cells to form sperms. This step is called spermiogenesis.

During this process one spermatogonium produces four sperms having half number of chromosomes.

Question 7.
Name the hormones involved in the regulation of spermatogenesis.
Solution:
The hormones involved in the regulation of spermatogenesis are:

• Gonadotropin-releasing hormone
• Luteinizing hormone (LH)
• Follicle-stimulating hormone
• Testosterone.

Question 8.
Define spermiogenesis and spermiation.
Solution:
The transformation of spermatid into sperm is called spermiogenesis. The release of sperm from the seminiferous tubules is called spermiation.

Question 9.
Draw a labelled diagram of sperm
Solution:

Question 10.
What are the major components of seminal plasma?
Solution:
Secretions of prostate gland, seminal vesicle and Cowper’s gland and , sperms together constitute semen.

Question 11.
What are the major functions of male accessory ducts and glands?
Solution:
The main functions of male accessory ducts and glands are as follows:

1. Functions of accessory ducts:

• Rete Testis: They transport sperms from seminiferous tubule to Vas efferentia.
• Vas efferentia: Transports sperms to epdidymis.
• Epididymis: Sperms are stored here. Maturation of sperms occurs.
• Vas deference: Transports sperms from the epididymis to the urethra.

2. Functions of glands:

• Prostate gland: It produces milky secretion which forms a considerable part of the semen. It makes sperm motile.
• Bulbourethral gland: Its secretion makes the penis lubricated.
• Seminal vesicle: It secretes mucus and watery alkaline fluid which provide energy to the sperm.

Question 12.
What is oogenesis? Give a brief account of oogenesis.
Solution:
Oogenesis is the production and growth of the ova (egg cell) in the ovary. It starts only after the female has attained puberty. The process is induced by FSH from the anterior pituitary. It leads to the growth of a single Graafian follicle in one of the two ovaries every month. The developing ovary is colonised by primordial germ cells prior to birth which differentiate into oogonia. These enlarge within the follicle under the influence of mitotic division to form primary oocyte containing diploid number of chromosomes. These undergo reductional division (1st meiotic division) to form a secondary oocyte and first polar body. The secondary oocyte proceeds with meiosis II but the division gets arrested until fertilisation occurs. The ‘egg’ is released at secondary oocyte stage under the effect of LH. A second polar body is extruded. The first polar body may also divide to form two polar bodies of equal sizes which do not take part in reproduction and ultimately degenerates. During oogenesis one oogonium produces one ovum and three polar bodies. Polar bodies containing small amount of cytoplasm helps to retain sufficient amount of cytoplasm in the ovum which is essential for the development of early embryo. Formation of polar bodies maintains the half number of chromosomes in the ovum.

Question 13.
Draw a labelled diagram of a section through ovary.
Solution:

Question 14.
Draw a labelled diagram of a Graafian follicle ?
Solution:

Question 15.
Give the functions of the following.

1. Corpus luteum
2. Endometrium
3. Acrosome
4. Sperm tail
5. Fimbriae

Solution:
The functions of the following:

1. Corpus luteum secretes a large amount of progesterone which is essential for the maintenance of the endometrium of the uterus.
2. Endometrium is necessary for the implantation of the fertillised ovum, for contributing towards the making of the placenta and other events of pregnancy.
3. Acrosome is filled with enzymes that help in dissolving the outer cover of the ovum and entry of sperm nucleus.
4. Sperm tail facilitates motility of the sperm essential for reaching the ovum to fertilize it.
5. Fimbriae are fingers-like projections at the mouth of fallopian tubules that help in the collection of the ovum after ovulation.

Question 16.
Identify True/False statements. Correct each false statement to make it true.

1. Androgens are produced by Sertoli cells.
2. Spermatozoa get nutrition from Sertoli cells.
3. Leydig cells are found in ovary.
4. Leydig cells synthesise androgens.
5. Oogenesis takes place in corpus luteum.
6. Menstrual cycle ceases during pregnancy.
7. Presence or absence of a hymen is not a reliable indicator of virginity Or sexual experience.

Solution:

1. False: Androgens are produced by interstitial cells or Leydig cells.
2. True
3. False: Leydig’s cells are found in the testes (in between the seminiferous tubules).
4. True
5. False: Oogenesis takes place in the ovary.
6. True
7. True

Question 17.
What is the menstrual cycle? Which hormones regulate the menstrual cycle?
Solution:
The recurring cycle of physiological changes in the uterus, ovaries and other sexual structures that occur from the beginning of one menstrual period through the beginning of the next is called menstrual cycle. The beginning of menstruation is called menarche. Hormones involved in the regulation of menstrual cycle are pituitary or ovarian hormones. These are LH, FSH, estrogen and progesterone.

Question 18.
What is parturition? Which hormones are involved in the induction of parturition?
Solution:

• The process of delivering of the fully developed fetus or baby at the end of the pregnancy period through vigorous contraction of the uterus is called parturition.
• Estrogen (amount of estrogen is more than progesterone) and oxytocin are the hormones involved in the induction of parturition.

Question 19.
In our society, women are often blamed for giving birth to daughters. Can you explain why this is not correct?
Solution:
This is not correct that women in our society are often blamed for giving birth to daughters because the sex of the baby is determined by the father, not by the mother. As we know that the chromosome pattern in the human female is XX and that in the male is XY.

Therefore, all the haploid gametes produced by the female (ova) have the sex chromosome X whereas in the male gametes (sperms) the sex chromosome could be either X or Y, hence, 50 per cent of sperms carry the X chromosome while the other 50 per cent carry the Y. After fusion of the male and female gametes the zygote would carry either XX or XY depending on whether the sperm carrying X or Y fertilised the ovum. The zygote carrying XX would develop into a female baby and XY would form a male.

Question 20.
How many eggs are released by a human ovary in a month? How many eggs do you think would have been released if the mother gave birth to identical twins? Would your answer change if the twins born were fraternal?
Solution:
Each ovary develops a number of immature eggs associated with groups of other cells called follicles. Normally, in humans, only one egg is released at one time; occasionally, two or more erupt during the menstrual cycle. The egg erupts from the ovary on the 14th to 16th day of the approximately 28 day menstrual cycle. Identical twins occur when a single egg is fertilised to form one zygote (monozygotic) which then divides into two separate embryos. And if the twins were born fraternal two eggs are released. Fraternal twins (commonly known as “non-identical twins”) usually occur when two fertilised eggs are implanted in the uterine wall at the same time. The two eggs form two zygotes, and these twins are therefore also known as dizygotic as well as “binovular” twins.

Question 21.
How many eggs do you think were released by the ovary of a female dog which gave birth to 6 puppies?
Solution:
One oogonium produces one ovum and three polar bodies. The ovum is the actual female gamete. The polar bodies take no part in reproduction and hence, soon degenerate. In human beings, ovum is released from the ovary in the secondary oocyte stage. So, six ova (eggs), were released by ovary of a female dog which gave birth to 6 puppies.

Exercises

Question 1.
Name the parts of an angiosperm flower in which development of male and female gametophyte take place.
Answer:
The male gametophyte or the pollen grain develops inside the pollen chamber of the anther, whereas the female gametophyte (also known as the embryo sac) develops inside the nucellus of the ovule from the functional megaspore.

Question 2.
Differentiate between microsporogenesis and megasporogenesis. Which type of cell division occurs during these events? Name the structures formed at the end of these two events.
Answer:

(b) Both events (microsporogenesis and megasporogenesis ) involve the process of meiosis or reduction division which results in the formation of haploid gametes from the microspore and megaspore mother cells.
(c) Microsporogenesis results in the formation of haploid microspores from a diploid microspore mother cell. On the other hand, megasporogenesis results in the formation of haploid megaspores from a diploid megaspore mother cell.

Question 3.
Arrange the following terms in the correct developmental sequence: Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes.
Answer:
The correct developmental sequence is as follows: Sporogenous tissue, pollen mother cell, microspore tetrad, pollen grain, male gametes. During the development of microsporangium, each cell of the sporogenous tissue acts as a pollen mother cell and gives rise to a microspore tetrad, containing four haploid microspores by the process of meiosis (microsporogenesis). As the anther matures, these microspores dissociate and develop into pollen grains. The pollen grains mature and give rise to male gametes.

Question 4.
With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.
Answer:
An ovule is a female megasporangium where the formation of megaspores takes place.

The various parts of a typical angiospermic ovule are as follows :

1. Funiculus : It is a stalk-like structure which represents the point of attachment of the ovule to the placenta of the ovary.
2. Hilum : It is the point where the body of the ovule is attached to the funiculus.
3. Integuments : They are the outer layers surrounding the ovule that provide protection to the developing embryo.
4. Micropyle : It is a narrow pore formed by the projection of integuments. It marks the point where the pollen tube enters the ovule at the time of fertilisation.
5. Nucellus : It is a mass of the parenchymatous tissue surrounded by the integuments from the outside. The nucellus provides nutrition to the developing embryo. The embryo sac is located inside the nucellus.
6. Chalaza : It is the based swollen part of the nucellus from where the integuments originate.

Question 5.
What is meant by monosporic development of female gametophyte?
Answer:
The female gametophyte or the embryo sac develops from a single functional megaspore. This is known as monosporic development of the female gametophyte. In most flowering plants, a single megaspore mother cell present at the micropylar pole of the nucellus region of the ovule undergoes meiosis to produce four haploid megaspores. Later, out of these four megaspores, only one functional megaspoxe develops into the female gametophyte, while the remaining three degenerate.

Question 6.
With a neat diagram explain the 7-celled, 8-nucleate nature of the female gametophyte.
Answer:

The female gametophyte (embryo sac) develops from a single functional megaspore. This megaspore undergoes three successive mitotic divisions to form eight nucleate embryo sacs. The first mitotic division in the megaspore forms two nuclei. One nucleus moves towards the micropylar end while the other nucleus moves towards the chalazal end. Then, these nuclei divide at their respective ends and re-divide to form eight nucleate stages. As a result, there are four nuclei each at both the ends i.e., at the micropylar and the chalazal end in the embryo sac. At the micropylar end, out of the four nuclei only three differentiate into two synergids and one egg cell. Together they are known as the egg apparatus. Similarly, at the chalazal end, three out of four nuclei differentiates as antipodal cells. The remaining two cells (of the micropylar and the chalazal end) move towards the centre and are known as the polar nuclei, which are situated in a large central cell. Hence, at maturity, the female gametophyte appears as a 7-celled structure, though it has 8-nucleate.

Question 7.
What are chasmogamous flowers? Can cross-pollination occur in cleistogamous flowers? Give reasons for your answer.
Answer:
There are two types of flowers present in plants namely Oxalis and Viola—chasmogamous and cleistogamous flowers. Chasmogamous flowers have exposed anthers and stigmata similar to the flowers of other species.
Cross-pollination cannot occur in cleistogamous flowers. This is because cleistogamous flowers never open at all. Also, the anther and the stigma lie close to each other in these flowers. Hence, only self-pollination is possible in these flowers.

Question 8.
Mention two strategies evolved to prevent self-pollination in flowers.
Answer:
Self-pollination involves the transfer of pollen from the stamen to the pistil of the same flower. Two strategies that have evolved to prevent self-pollination in flowers are given on next page:

1. Self-incompatibility : In certain plants, the stigma of the flower has the capability to prevent the germination of pollen grains and hence, prevent the growth of the pollen tube. It is a genetic mechanism to prevent self-pollination called self-incompatibility. Incompatibility may be between individuals of the same species or between individuals of different species. Thus, incompatibility prevents breeding.
2. Protandry : In some plants, the gynoecium matures before the androecium or vice-versa. This phenomenon is known as protogyny or protandry respectively. This prevents the pollen from coming in contact with the stigma of the same flower.

Question 9.
What is self-incompatibility? Why does self-pollination not lead to seed formation in self-incompatible species?
Answer:
Self-incompatibility is a genetic mechanism in angiosperms that prevents self-pollination. It develops genetic incompatibility between ‘ individuals of the same species or between individuals of different species.

The plants which exhibit this phenomenon have the ability to prevent germination of pollen grains and thus, prevent the growth of the pollen tube on the stigma of the flower. This prevents the fusion of the gametes along with the development of the embryo. As a result, no seed formation takes place.

Question 10.
What is bagging technique? How is it useful in a plant breeding ‘ programme?
Answer:
Various artificial hybridisation techniques (under various crop , improvement programmes) involve the removal of the anther from bisexual flowers without affecting the female reproductive part (pistil) through the process of emasculation. Then, these emasculated flowers are wrapped in bags to prevent pollination by unwanted pollen grains.

This process is called bagging. This technique is an important part of the plant breeding programme as it ensures that pollen grains of only desirable plants are used for fertilisation of the stigma to develop the desired plant variety.

Question 11.
What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.
Answer:
Triple fusion is the fusion of the male gamete with two polar nuclei inside the embryo sac of the angiosperm. This process of fusion takes place inside the embryo sac.

When pollen grains fall on the stigma, they germinate and give rise to the pollen tube that passes through the style and enters into the ovule. After this, the pollen tube enters one of synergids and releases two male gametes there.

Out of the two male gametes, one gamete fuses with the nucleus of the egg cell and forms the zygote (syngamy). The other male gamete fuses with the two polar nuclei present in the central cell to form a triploid primary endosperm nucleus. Since this process involves the fusion of three haploid nuclei, it is known as triple fusion. It results in the formation of the endosperm. One male gamete nucleus and two polar nuclei are involved in this process.

Question 12.
Why do you think the zygote is dormant for sometime in a fertilised ovule?
Answer:
The zygote is formed by the fusion of the male gamete with the nucleus of the egg cell. The zygote remains dormant for some time and waits for the endosperm to form, which develops from the primary endosperm cell resulting from triple fusion. The endosperm provides food for the growing embryo and after the formation of the endosperm, further development of the embryo from the zygote starts.

Question 13.
Differentiate between:
(a) hypocotyl and epicotyl;
(b) coleoptile and coleorrhiza;
(c) integument and testa;
(d) perisperm and pericarp.
Answer:

Question 14.
Why is apple called a false fruit? Which part(s) of the flower forms the fruit?
Answer:
Fruits derived from the ovary and other accessory floral parts are called false fruits. On the contrary, true fruits are those fruits which develop from the ovary, but do not consist of the thalamus or any other floral part. In an apple, the fleshy receptacle forms the main edible part. Hence, it is a false fruit.

Question 15.
What is meant by emasculation? When and why does a plant breeder employ this technique?
Answer:
Emasculation is the process of removing anthers from bisexual flowers ! without affecting the female reproductive part (pistil), which is used in various plant hybridisation techniques.

Emasculation is performed by plant breeders in bisexual flowers to obtain the desired variety of a plant by crossing a particular plant with the desired pollen grain. To remove the anthers, the flowers are f covered with a bag before they open. This ensures that the flower is pollinated by pollen grains obtained from desirable varieties only. Later, the mature, viable, and stored pollen grains are dusted on the bagged stigma by breeders to allow artificial pollination to take place and obtain the desired plant variety.

Question 16.
If one can induce parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?
Answer:
Parthenocarpy is the process of developing fruits without involving the process of fertilisation or seed formation. Therefore, the seedless f varieties of economically important fruits such as orange, lemon, water melon etc. are produced using this technique. This technique involves inducing fruit formation by the application of plant growth hormones such as auxins.

Question 17.
Explain the role of tapetum in the formation of pollen-grain i wall.
Answer:
Tapetum is the innermost layer of the microsporangium. It provides nourishment to the developing pollen grains. During microsporogenesis, the cells of tapetum produce various enzymes, hormones, amino acids, and other nutritious material required for the ‘ development of pollen grains. It also produces the exine layer of the pollen grains, which is composed of the sporopollenin.

Question 18.
What is apomixis and what is its importance?
Answer:
Apomixis is the mechanism of seed production without involving the process of meiosis and syngamy. It plays an important role in hybrid seed production. The method of producing hybrid seeds by cultivation is very expensive for farmers. Also, by sowing hybrid seeds, it is difficult to maintain hybrid characters as characters segregate during meiosis. Apomixis prevents the loss of specific characters in the hybrid. Also, it is a cost-effective method for producing seeds.